A person is injured and got swelling. The swelling, due to the infection of tissue is an example of:
a.
Phagocytosis
b.
Mechanical barrier
c.
Inflammation
Correct Answer
d.
Physiological barrier
Step-by-Step AI Explanation
Verified Method
Swelling due to infection or tissue injury is a sign of inflammation. Inflammation is the body's protective response to remove the injurious agent and initiate healing. Phagocytosis is the ingestion of microbes by cells, while mechanical and physiological barriers are first-line defenses that prevent entry of pathogens.
Q2mcq1 mark
The first codon to be deciphered was ____________ which codes for __________.
a.
UUU, Phenylalanine
Correct Answer
b.
AAA, Proline
c.
TTT, Arginine
d.
GGG, Alanine
Step-by-Step AI Explanation
Verified Method
The first codon to be deciphered was UUU, which codes for phenylalanine. This was established during the early genetic code experiments. The other options are incorrect because AAA does not code for proline, TTT is a DNA triplet not an mRNA codon, and GGG codes for glycine, not alanine.
Klinefelter’s syndrome is wrongly matched here because it is found in a male with an extra X chromosome, i.e. XXY male, not XXY female. Down’s syndrome is trisomy 21, Turner’s syndrome is XO female, and Patau’s syndrome is trisomy 13.
Q4mcq1 mark
The Neanderthal man had the brain capacity of:
a.
900 cc
b.
650-800 cc
c.
1400 cc
d.
1200 cc
Correct Answer
Step-by-Step AI Explanation
Verified Method
The Neanderthal man had a brain capacity of about 1200 cc. Hence option (d) is correct. The other values do not represent the accepted brain capacity of Neanderthals.
Q5mcq1 mark
Which one of the following groups includes sexually transmitted diseases caused by bacteria only?
a.
Syphilis, gonorrhoea and trichomoniasis
b.
Syphilis, gonorrhoea and candidiasis
c.
Syphilis, trichomoniasis and pediculosis
d.
Syphilis, chlamydiasis and gonorrhoea
Correct Answer
Step-by-Step AI Explanation
Verified Method
Syphilis, chlamydiasis and gonorrhoea are all bacterial sexually transmitted diseases. Syphilis is caused by Treponema pallidum, gonorrhoea by Neisseria gonorrhoeae, and chlamydiasis by Chlamydia trachomatis. Trichomoniasis is protozoan and candidiasis is fungal, so the other options are not correct.
Q6mcq1 mark
ELISA is mainly used for:
a.
Selecting animals having desired traits
b.
Detection of mutations
c.
Selecting plants having desired traits
d.
Detection of pathogens
Correct Answer
Step-by-Step AI Explanation
Verified Method
ELISA is mainly used for detection of pathogens and antibodies/antigens in diagnostic tests. It is a sensitive immunological assay widely used in disease diagnosis. The other options refer to plant/animal selection or mutation detection, which are not the primary use of ELISA.
Q7mcq1 mark
The most important hormone in initiating and maintaining lactation after birth is:
a.
Prolactin
Correct Answer
b.
Oestrogen
c.
Oxytocin
d.
FSH
Step-by-Step AI Explanation
Verified Method
Prolactin is the most important hormone for initiating and maintaining lactation after birth. It stimulates milk production in the mammary glands. Oestrogen and FSH are mainly involved in reproductive development, while oxytocin helps in milk ejection, not milk synthesis.
Q8mcq1 mark
Assertion: The environmental conditions of the Tropics are favourable for speciation and diversity of organisms.
Reason: The climate seasons, temperature, humidity and photoperiod are more or less stable and congenial.
a.
Assertion is true, but Reason is false.
b.
Both Assertion and Reason are true and Reason explains Assertion correctly.
Correct Answer
c.
Both Assertion and Reason are false.
d.
Both Assertion and Reason are true but Reason is not the correct explanation of Assertion.
Step-by-Step AI Explanation
Verified Method
Both the Assertion and the Reason are true, and the Reason correctly explains the Assertion. Tropical regions have relatively stable climate, temperature, humidity and photoperiod throughout the year, which promotes survival, specialization and ultimately higher speciation and biodiversity.
Q9mcq1 mark
The figure given below is a diagrammatic representation of response of organisms to abiotic factors. What do A, B and C represent respectively?
The correct answer is (d) Regulator, Partial Regulator, Conformer. Organisms that maintain a constant internal environment despite external changes are called regulators. Those that can regulate only to a limited extent are partial regulators. Organisms that allow their internal conditions to change with the environment are conformers. Hence A, B and C represent regulator, partial regulator and conformer respectively.
Q10mcq1 mark
The mode of sexual reproduction in bacteria is by:
a.
Conjugation
Correct Answer
b.
Formation of gametes
c.
Zoospore formation
d.
Endospore formation
Step-by-Step AI Explanation
Verified Method
The mode of sexual reproduction in bacteria is conjugation, so (a) is correct. In bacteria, genetic material is transferred from one cell to another through direct contact during conjugation. Formation of gametes does not occur in bacteria, and zoospore and endospore formation are asexual/survival processes, not sexual reproduction.
🎉 10 Free Sample Solutions Completed
Unlock All 30 Questions & Solutions
Sign up free in seconds to unlock step-by-step AI answers for the remaining 20 questions.
If the coding sequence in a transcription unit is written as follows :
$5'$
TGCATGCATGCATGCATGCATGCATGC $3'$
Write down the nucleotide sequence of mRNA.
Correct Answer & Step-by-Step Solution Locked
Sign in free to reveal the correct answer and AI explanation for this question.
